3A). (20 g for total RNA) were electrophoresed through formaldehyde-agarose gels and transferred to a nylon membrane (Hybond N, Amersham). Membranes were hybridized with 32P-labeled murine -casein, Id-1 and Id-2 cDNA probes (6). Membranes were washed and exposed to XAR-5 film for autoradiography. 28S and 18S ribosomal RNA are shown as controls for RNA integrity and quantitation. Polymerase chain reaction Transcripts for ITF-2A, ITF-2B and Roflumilast N-oxide for GAPDH were reverse transcribed using Superscript Reverse Transcriptase Rabbit Polyclonal to PLG II (Gibco-BRL), and polymerase chain reaction performed. PCR was performed in buffer containing 1 M of each of the 5 and 3 PCR primer and 0.5 U of Taq polymerase using 28 cycles for amplification of ITF-2 cDNAs and 25 cycles for amplification of GAPDH cDNA. The 5 PCR primer was GTCCGAAAAGTTCCTCCGGGTTTGCCGTCT for ITF-2A and TCCAATCCTTCAACTCCTGTGGGCTCCCCT for ITF-2B; the 3 PCR primer was TTCCTTCTCGCGCTCAGCCTTCTG for both ITF-2A and ITF-2B. The 5 PCR primer for GAPDH was ACCACAGTCCATGCCATCAC and the 3 PCR primer was TCCACCACCCTGTT GCTGTA. The cycle conditions for ITF-2A and ITF-2B were 50 sec denaturation at 94C, 50 sec annealing at 62C, and 180 sec extension at 72C. The cycle conditions for GAPDH were 30 sec denaturation at 94C, 30 sec annealing at 60C, and 60 sec extension at 72C. Immunohistochemical analysis Paraffin-embedded tissue sections (5 m) from mouse mammary glands were deparaffinized in xylene, rehydrated with ethanol, rinsed in PBS, and incubated for 10 min at 37C with 0.1% trypsin. Sections were incubated with a mouse antibody against keratin 8/18 (Sigma-2931), a mouse antibody against alpha-smooth muscle actin (Sigma-2547), a rabbit polyclonal antibody against keratin 14 (PRB-155P, Covance/Babco) or a rabbit polyclonal antibody against Id-1 (C-20, Santa Cruz Biotechnology) in the presence or absence of Id-1 blocking peptide. Tissue sections were washed and incubated with biotinylated secondary antibodies. Slides were then incubated for 30 min with anti-IgG conjugated with horseradish peroxidase (Santa Cruz Biotechnology, CA), and the reaction revealed by incubating with 3, 3 diaminobenzidine. Sections were briefly counterstained with Mayers hematoxylin, dehydrated in graded alcohols, cleared in methyl cyclohexane and mounted. In situ hybridization To localize of Id-1 mRNA in the mammary glands, we used deparaffinized sections (5 m) treated with proteinase K (5 g/ml) and hybridized overnight with digoxigenin-labeled probes that were prepared from appropriately linearized plasmids. A 650bp mouse Id-1 cDNA sequence was used (PvuII-XhoI restriction sites). The cDNA sequences spanned protein coding regions outside of the helix-loop-helix consensus region were inserted into the (EcoRV-XhoI restriction sites) of a Bluescript plasmid (Stratagene). As a negative control, sense fragments were hybridized to adjacent sections. After hybridization at 47C, sections were treated with RNase A for 10 minutes at 37C, followed by stringent washes before autoradiography with NTB2 emulsion. Yeast two-hybrid system To determine the interactions amongst the different helix-loop-helix proteins, we used the yeast two-hybrid system (Parrinello et al., 2001). Parental yeast vector pGADT7 and pGBKT7 were purchased from Clontech (Palo Alta, CA). The 1.2 kb Id-1 fragment containing the entire coding region was cloned into pGADT7. The 600 bp Id-2 fragment containing the entire coding region was amplified by PCR and cloned into pGADT7. ITF-2A/Pgk and ITF-2B/Pgk were gifts from Dr. Skerjanc. The ITF-2A (1.5 kb) and ITF-2B (2 kb) fragments containing the entire coding region were cloned into pGBKT7. pGADT7 and pGBKT7 plasmids were simultaneously co-transformed into Y187 yeast for colony lift filter assay to measure -galactosidase activity. Each Roflumilast N-oxide co-transformed Y187 strain was plated on selection plates. Fresh colonies were transferred to Duralose UV Roflumilast N-oxide TM membranes (Stratagene) and frozen in liquid nitrogen. Filters were then thawed at room temperature, placed on the presoaked 3MM paper with Z buffer/X-gal solution and incubated at 30C until blue color is detected. Results Id-1 expression during early pregnancy We previously examined Id-1 mRNA expression during normal mouse mammary gland development similar to that observed in cultured mammary epithelial cells (5). However, it was claimed that Id-1 was not expressed in epithelial cells in mouse mammary gland, but in the cytoplasm of.Parental yeast vector pGADT7 and pGBKT7 were purchased from Clontech (Palo Alta, CA). factors whose expression is modulated during different stages of pregnancy in mouse mammary glands. hybridization. RNA isolation and northern analysis RNA was extracted using TriPure Isolation Reagents (Boehringer Mannheim). Samples (20 g for total RNA) were electrophoresed through formaldehyde-agarose gels and transferred to a nylon membrane (Hybond N, Amersham). Membranes were hybridized with 32P-labeled murine -casein, Id-1 and Id-2 cDNA probes (6). Membranes were washed and exposed to XAR-5 film for autoradiography. 28S and 18S ribosomal RNA are shown as controls for RNA integrity and quantitation. Polymerase chain reaction Transcripts for ITF-2A, ITF-2B and for GAPDH were reverse transcribed using Superscript Reverse Transcriptase II (Gibco-BRL), and polymerase chain reaction performed. PCR was performed in buffer containing 1 M of each of the 5 and 3 PCR primer and 0.5 U of Taq polymerase using 28 cycles for amplification of ITF-2 cDNAs and 25 cycles for amplification of GAPDH cDNA. The 5 PCR primer was GTCCGAAAAGTTCCTCCGGGTTTGCCGTCT for ITF-2A and TCCAATCCTTCAACTCCTGTGGGCTCCCCT for ITF-2B; the 3 PCR primer was TTCCTTCTCGCGCTCAGCCTTCTG for both ITF-2A and ITF-2B. The 5 PCR primer for GAPDH was ACCACAGTCCATGCCATCAC and the 3 PCR primer was TCCACCACCCTGTT GCTGTA. The cycle conditions for ITF-2A and ITF-2B were 50 sec denaturation at 94C, 50 sec annealing at 62C, and 180 sec extension at 72C. The cycle conditions for GAPDH were 30 sec denaturation at 94C, 30 sec annealing at 60C, and 60 sec extension at 72C. Immunohistochemical analysis Paraffin-embedded tissue sections (5 m) from mouse mammary glands were deparaffinized in xylene, rehydrated with ethanol, rinsed in PBS, and incubated for 10 min at 37C with 0.1% trypsin. Sections were incubated with a mouse antibody against keratin 8/18 (Sigma-2931), a mouse antibody against alpha-smooth muscle actin (Sigma-2547), a rabbit polyclonal antibody against keratin 14 (PRB-155P, Covance/Babco) or a rabbit polyclonal antibody against Id-1 (C-20, Santa Cruz Biotechnology) in the presence or absence of Id-1 blocking peptide. Tissue sections were washed and incubated with biotinylated secondary antibodies. Slides were then incubated for 30 min with anti-IgG conjugated with horseradish peroxidase (Santa Cruz Biotechnology, CA), and the reaction revealed by incubating with 3, 3 diaminobenzidine. Sections were briefly counterstained with Mayers hematoxylin, dehydrated in graded alcohols, cleared in methyl cyclohexane and mounted. In situ hybridization To localize of Id-1 mRNA in the mammary glands, we used deparaffinized sections (5 m) treated with proteinase K (5 g/ml) and hybridized overnight with digoxigenin-labeled probes that were prepared from appropriately linearized plasmids. A 650bp mouse Id-1 cDNA sequence was used (PvuII-XhoI restriction sites). The cDNA sequences spanned protein coding regions outside of the helix-loop-helix consensus region were inserted into the (EcoRV-XhoI restriction sites) of a Bluescript plasmid (Stratagene). As a negative control, sense fragments were hybridized to adjacent sections. After hybridization at 47C, sections were treated with RNase A for 10 minutes at 37C, followed by stringent washes before autoradiography with NTB2 emulsion. Yeast two-hybrid system To determine the interactions amongst the different helix-loop-helix proteins, we used the yeast two-hybrid system (Parrinello et al., 2001). Parental yeast vector Roflumilast N-oxide pGADT7 and pGBKT7 were purchased from Clontech (Palo Alta, CA). The 1.2 kb Id-1 fragment containing the entire coding region was cloned into pGADT7. The 600 bp Id-2 fragment containing the entire coding region was amplified by PCR and cloned into pGADT7. ITF-2A/Pgk and ITF-2B/Pgk were gifts from Dr. Skerjanc. The ITF-2A (1.5 kb) and ITF-2B (2 kb) fragments containing the entire coding region were cloned into pGBKT7. pGADT7 and pGBKT7 plasmids were simultaneously co-transformed into Y187 yeast for colony lift filter assay to measure -galactosidase activity. Each co-transformed Y187 Roflumilast N-oxide strain was plated on selection plates. Fresh colonies were transferred to Duralose UV TM membranes (Stratagene) and frozen in liquid nitrogen. Filters were then thawed at room temperature, placed on the presoaked 3MM paper with Z buffer/X-gal solution and incubated at 30C until blue color is detected. Results Id-1 expression during early pregnancy We previously examined Id-1 mRNA expression during normal mouse mammary gland development similar to that observed in cultured mammary.