All human disc samples were separated according to the guideline of the Ethics Committee at the First Affiliated Hospital of Soochow University [KYDD (SU) 2009-0102], and the ethical standards described by the Declaration of Helsinki. Patient information Seven patients (three male and four female) who underwent discectomy due to disc herniation were involved in the present study. partly inhibited these protective effects of BMP-7 against senescence of human disc NP cells. Conclusion: BMP-7 alleviates subculture-induced senescence of human disc NP cells through activating the PI3K/Akt pathway. The present study provides new knowledge on allogeneic disc NP cell-based TE strategy to regenerate degenerative human disc tissue. and studies have indicated that BMP-7 is efficient in retarding disc degeneration through enhanced disc cell viability and matrix anabolism [15C20]. Hence, the present study is aimed to investigate whether BMP-7 can alleviate subculture-induced senescence of human disc NP cells. Materials and methods Ethical statement In the present study, all patients have signed the informed consent before sample acquisition. All human disc samples were separated according to the guideline of the Ethics Committee at the First Affiliated Hospital of Soochow University [KYDD (SU) 2009-0102], and the ethical standards Anemarsaponin B described by the Declaration of Helsinki. Patient information Seven patients (three male and four female) who underwent discectomy due to disc herniation were involved in the present study. In the present study, the surgeon just collected the most central disc samples for the process of cell isolation. The mean patient age was 47 years. The Anemarsaponin B Thompson Grading System is used to score disc degeneration stages from Thompson Grade I to Thompson Grade V [21]. Here, there were three patients (one male and two female) with Grade III degeneration and four patients (two male and two female) with Grade IV degeneration. NP cell isolation and culture Briefly, after the removed disc tissue samples were washed with PBS for three-times, the tissue samples further separated the disc NP tissues under a dissecting microscope. Then, the NP tissue underwent enzymatic digestion using 0.25% trypsin (Gibco, U.S.A.) and 0.20% collagenase (SigmaCAldrich, U.S.A.) according to a previous method [22]. Then, NP cell pellets were obtained by centrifugation (1000 rpm) for 5 min at 4C. Finally, the isolated NP cells were cultured in DMEM/F12 medium containing 20% FBS (Gibco, U.S.A.). The cultured medium was exchanged every 2 days. Generally, NP cells were subcultured for 5 passages was used as a reference gene. The PCR protocol is: 95C for 3 min, followed by 35 cycles of 95C for 10 s, 56C for 15 s, and 72C for 30 s. The primers (Table 1) were purchased from a domestic bio-company (Shanghai Shenggong, China). The relative gene expression was calculated according to the method of 2DCt. Table 1 Primers of target genes
-actinCCGCGAGTACAACCTTCTTGTGACCCATACCCACCATCACP53CCTTAAGATCCGTGGGCGTGCTAGCAGTTTGGGCTTTCCP16TACCCCGATACAGGTGATGATACCGCAAATACCGCACGA Open in a separate window Western blot analysis Briefly, total protein from the P6 human disc NP cells was extracted using RIPI lysis buffer (Beyotime, China). Then, protein supernatant samples were separated by SDS/PAGE and transferred on to the PVDF membranes. Subsequently, the PVDF membranes were incubated with primary antibodies (-actin: Abcam, ab8226; p16: Abcam, ab108349; p53: Abcam, ab1101; Akt: Cell Signaling Technology, #4685; p-Akt: Cell Signaling Technology, #9271) at 4C overnight and second antibodies at 37C for 2 h. Finally, protein bands were visualized using a BeyoECL Plus Kit (Beyotime, China) and analyzed using the ImageJ software. Statistical analysis All data are expressed as mean S.D. of three independent experiments. The data were analyzed using SPSS 19.0 software. The statistical difference was analyzed using a one-way ANOVA. A value of P<0.05 was considered as Rabbit Polyclonal to VE-Cadherin (phospho-Tyr731) a statistical difference. Results Cell proliferation Results showed that proliferation potency of human disc NP cells treated with BMP-7 was significantly increased compared with the control NP cells. However, when the inhibitor LY294002 was added into the culture medium of human disc NP cells treated with BMP-7, their proliferation potency was partly decreased (Figure 1). Open in a separate window Figure 1 BMP-7 increased cell proliferation of P6 human disc NP cellsNP cell proliferation was measured by CCK-8 assay. Data are shown as mean S.D., n=3. *: Anemarsaponin B Indicates a significant difference (P<0.05). Telomerase activity Compared with the control NP cells, telomerase activity of human disc NP cells treated with BMP-7 was significantly increased. However, the inhibitor LY294002 partly decreased the telomerase activity of human disc NP cells treated with BMP-7 (Figure 2). Open in a separate window Figure 2 BMP-7 decreased telomerase activity of P6 human disc NP cellsTelomerase activity was measured using a chemical kit. Data are shown as mean S.D., n=3. *: Indicates a significant difference (P<0.05). SA--Gal activity Compared with the control NP cells, SA--Gal.